View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7850A_low_340 (Length: 246)

Name: NF7850A_low_340
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7850A_low_340
NF7850A_low_340
[»] chr3 (1 HSPs)
chr3 (51-228)||(53388248-53388425)
[»] chr8 (2 HSPs)
chr8 (101-228)||(10597537-10597664)
chr8 (1-135)||(10597666-10597800)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 51 - 228
Target Start/End: Complemental strand, 53388425 - 53388248
Alignment:
51 attacaggactataatcttcgttgattaatccatttggtagcattgtagtctttgctctctcacttgatgcagaatcaacatgcgaccgagattcacttc 150  Q
    |||||||||||| |||| || ||||||||||||| |||||||||||||| ||||| |||||||||||| | |||||||||||||||||||||||||||||    
53388425 attacaggactacaatcctcattgattaatccatctggtagcattgtaggctttgttctctcacttgacgtagaatcaacatgcgaccgagattcacttc 53388326  T
151 caccatcatcatccttcatacagaaatattccttgggacttccattaccagtaccttcagatgaatctttttctgatg 228  Q
    |||| ||||||||||||||||| || | ||||||||||||||| | || | |||||||||||||||||||||||||||    
53388325 caccgtcatcatccttcatacataattgttccttgggacttccctcactaataccttcagatgaatctttttctgatg 53388248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 101 - 228
Target Start/End: Complemental strand, 10597664 - 10597537
Alignment:
101 ctttgctctctcacttgatgcagaatcaacatgcgaccgagattcacttccaccatcatcatccttcatacagaaatattccttgggacttccattacca 200  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||| || |    
10597664 ctttgttctctcacttgatgcagaatcaacatgcgaccgagattcacttctaccatcatcatccttcatacagaactgttccttgggacttccatcacta 10597565  T
201 gtaccttcagatgaatctttttctgatg 228  Q
    ||||||||||||||||||||||||||||    
10597564 gtaccttcagatgaatctttttctgatg 10597537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 10597800 - 10597666
Alignment:
1 aatccgttttgtcagaaaaattacttgtggaatccaatgcatcagcagcaattacaggactataatcttcgttgattaatccatttggtagcattgtagt 100  Q
    ||||||||||||||  || || ||||||||||||| ||||||||||||| |||||||||||   ||| || |||||||||||||||||||||||||| ||    
10597800 aatccgttttgtcaacaagatcacttgtggaatccgatgcatcagcagccattacaggactgctatcctcattgattaatccatttggtagcattgtggt 10597701  T
101 ctttgctctctcacttgatgcagaatcaacatgcg 135  Q
    ||||| |||||||||| ||||||||||||||||||    
10597700 ctttgttctctcacttaatgcagaatcaacatgcg 10597666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University