View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7850A_low_341 (Length: 246)

Name: NF7850A_low_341
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7850A_low_341
NF7850A_low_341
[»] chr7 (1 HSPs)
chr7 (126-195)||(32739192-32739261)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 126 - 195
Target Start/End: Original strand, 32739192 - 32739261
Alignment:
126 agtaatattgacatttgtctgtgtttgttatggtttgtcgttggtgaggtaaactaaatctttgaatctg 195  Q
    |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||    
32739192 agtaatattgacatttgtctgtgtttgttatggtttctctttggtgaggtaaactaaatctttggatctg 32739261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University