View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_342 (Length: 246)
Name: NF7850A_low_342
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_342 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 4083115 - 4082897
Alignment:
| Q |
20 |
ttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4083115 |
ttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgct |
4083016 |
T |
 |
| Q |
120 |
aatcctattagggagaatgaaaaatatagaaatggacctatcaatgaattattggcattgccatcaggcattcttcttcccatgacaaaggctattatct |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||| ||| |||| |||||||||||||||||| | ||||||| |
|
|
| T |
4083015 |
aatcctattagggagaatgaaaaatttagaaatggacctattaataaattgttggcattgtcatagggcaatcttcttcccatgacaaaagatattatcg |
4082916 |
T |
 |
| Q |
220 |
atgtaagtgatttctattg |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4082915 |
atgtaagtgatttctattg |
4082897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 67 - 110
Target Start/End: Original strand, 48203029 - 48203072
Alignment:
| Q |
67 |
ttcttcgaaatcgaacactacatagagttgtgattatggcaatg |
110 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
48203029 |
ttcttcggaatcgaaaactacatatagttgtgattatggcaatg |
48203072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University