View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_345 (Length: 245)
Name: NF7850A_low_345
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_345 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 26496588 - 26496375
Alignment:
| Q |
11 |
tcgcttcatagcaagcatctgtaagtacaataaactcatatgattaatcaacctcatagatttatcaaatttatagccaccagttattagttaaataaat |
110 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496588 |
tcgcttcatagcaagcatctgtaagcacaataaactcatacgagtaatcaacctcatagatttatcaaatttatagccaccagttattagttaaataaat |
26496489 |
T |
|
| Q |
111 |
ttcgatgacatgataatgtgattgtatcatagtgcaatggttgaacnnnnnnngcgtgacatgatgagacaaaatctaaacaaaattgatagtaggcgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496488 |
ttcgatgacatgataatgtgattgtatcatagtgcaatggttgaacaaaaaaagcgtgacatgatgagacaaaatctaaacaaaattgatagtaggcgat |
26496389 |
T |
|
| Q |
211 |
tcgccccatatttc |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26496388 |
tcgccccatatttc |
26496375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 77
Target Start/End: Original strand, 17755636 - 17755694
Alignment:
| Q |
21 |
gcaagcatctgtaagtacaataaactcatatgattaatc--aacctcatagatttatca |
77 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
17755636 |
gcaagcatctgacagtacaataaacttatatgagtaatcaaaacctcatagatttatca |
17755694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 77
Target Start/End: Original strand, 17764623 - 17764681
Alignment:
| Q |
21 |
gcaagcatctgtaagtacaataaactcatatgattaatc--aacctcatagatttatca |
77 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
17764623 |
gcaagcatctgacagtacaataaacttatatgagtaatcaaaacctcatagatttatca |
17764681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University