View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_35 (Length: 434)
Name: NF7850A_low_35
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 78 - 256
Target Start/End: Original strand, 4119639 - 4119818
Alignment:
| Q |
78 |
aataaaacttcatata--ttttttattgaattaattcttatcaagagatatatatgaaacatcacaggcgaacgaggaaaaggcgtttgacgattcatga |
175 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4119639 |
aataaaacttcatatacattttttattgaattagttcttatcaagagatat--atgaaacatcacaggcgaacgaggaaaaggcatttgacgattcatga |
4119736 |
T |
 |
| Q |
176 |
caactctgtcgtgacattttagaagattccgatacggtggtcagagaattcagtttccttg-agtctgagatatgttaactg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
4119737 |
caactctgtcgtgacattttagaagattctgatacagtggtcagggaattcagtttccttgaagcctgagatatgtcaactg |
4119818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 11 - 79
Target Start/End: Original strand, 4119340 - 4119408
Alignment:
| Q |
11 |
gatgaactttgtggtgacgtttcatgagatatgatgaattgggaacatactgatcatcatagtctagaa |
79 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4119340 |
gatgaactttgtggtgacgtttcaggagatatgatgaattgggaacatgctgatcatcatagtctagaa |
4119408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University