View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_352 (Length: 244)
Name: NF7850A_low_352
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_352 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 21 - 240
Target Start/End: Complemental strand, 4055130 - 4054910
Alignment:
| Q |
21 |
cataacagtaatatctttgtttctctgtttctcttccccaacaacattgatatgtctttctaaacaccaacgttaaacaaaacaaaatttgtttcagaag |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055130 |
cataacagtgatatctttgtttctctgtttctcttccccaacaacattgatatgtctttctaaacaccaacgttaaacaaaacaaaatttgtttcagaag |
4055031 |
T |
 |
| Q |
121 |
acactctttgtttcgaagtttgactgtgttt-atgtgtttttctctcgaagtgtctacacaaagtaaaatccgaatagggttattgggtcggtgggtcgg |
219 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4055030 |
acactctttgtttcgaagtttcactgtgtttaatgtgtttttctctcgaactgtctacacaaagtaagatccgaatagggttattgggtcggtgggtcgg |
4054931 |
T |
 |
| Q |
220 |
gtcatcatattcttggacatc |
240 |
Q |
| |
|
|||||| | || ||||||||| |
|
|
| T |
4054930 |
gtcatcgttttattggacatc |
4054910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University