View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_371 (Length: 242)
Name: NF7850A_low_371
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_371 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 25014790 - 25014549
Alignment:
| Q |
1 |
tggagttcagataaccaggattcaatattnnnnnnnntattgatattgcggcctaaattgtagttgcaggtctttttcaaattccgcggtttaacctaat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25014790 |
tggagttcggataaccaggattcaatattaaaaaaaatattgatattgcggcctaaattgcagttgcaggtctttttcaaattccgcggtttaacctaat |
25014691 |
T |
|
| Q |
101 |
gagtgaaannnnnnnggttctttaatttctctattgtggaataatgctaatgttaagtgttaaatattgcatggacaagcagatgtgaattcactaatgc |
200 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
25014690 |
gagtgaaatttttttagttctttaatttctctatagtggaataatgctaatgttaagtgttaaattttgcagagacaagcagacgtgaattcactaatgc |
25014591 |
T |
|
| Q |
201 |
tgctattggcattgttatgccatttgcttccattgctattca |
242 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25014590 |
tgcttttggcattgttatgccatttgcttccattgctattca |
25014549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University