View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_372 (Length: 242)
Name: NF7850A_low_372
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_372 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 54 - 240
Target Start/End: Complemental strand, 35679327 - 35679141
Alignment:
| Q |
54 |
tctttgtgtttagcaagtggagcaattatgctggatgtgtggctgggcatttctctttgctgtggtttttaattgcggtggttcatcattaagttcatgc |
153 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35679327 |
tctttgtgtttagcaagtggagcaataatgttggatgtgtggctgggcatttttctttggtgtggtttttaattgcggcggttcatcattaagttcatgc |
35679228 |
T |
 |
| Q |
154 |
aattttgattgtagaggtaccaaagctagtttccaggtgattgatatataatatgctgcatagcgatccaaaacttgcataattgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35679227 |
aattttgattgtagaggtaccaaagctagtttgcaggtgattgatatataatatgctgcatagcgatccaaaatttgcataattgtg |
35679141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University