View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_379 (Length: 241)
Name: NF7850A_low_379
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_379 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 14 - 163
Target Start/End: Complemental strand, 35559179 - 35559030
Alignment:
| Q |
14 |
tggtggtaaggggaaaaccttgcctcgtgtaacgaatcgtgatgacgagattaatgacacgataccgagtttgggatcggagactaatttcaggaatggg |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35559179 |
tggtggtaaggggaaaaccttgcctcgggtaacgaatcgtgatgacgagattaatgacacgataccgagtttgggatcggagactaatttcaggaatggg |
35559080 |
T |
|
| Q |
114 |
aagtatttgtattattcgcgaggtggtgattattgtaagggtatgaatca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35559079 |
aagtatttgtattattcgcgaggtggtgattattgtaagggtatgaatca |
35559030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University