View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_389 (Length: 239)
Name: NF7850A_low_389
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_389 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 2787435 - 2787258
Alignment:
| Q |
8 |
tggtgtttgtggcgatcgctttttcggattatagggtgagtaattgtttgtttcctggacatgaaagggaaatggatcaagttatggagagttttccatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787435 |
tggtgtttgtggcgatcgctttttcggattatagggtgagtaattgtttgtttcctggacatgaaagggaaatggatcaagttatggagagttttccatt |
2787336 |
T |
|
| Q |
108 |
gatggttggaattgtttgtagcggtttgtttcttatttttccaacttcaaggcgtggaattggctgcatggctgccta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
2787335 |
gatggttggaattgtttgtagcggtttgtttcttatttttccaacttcaaggcgtggaattggatgcatgtctgccta |
2787258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 8 - 177
Target Start/End: Original strand, 19578159 - 19578328
Alignment:
| Q |
8 |
tggtgtttgtggcgatcgctttttcggattatagggtgagtaattgtttgtttcctggacatgaaagggaaatggatcaagttatggagagttttccatt |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| | ||||||||| |||||||||||||||| || |||||||||||||||||||||||||| || |
|
|
| T |
19578159 |
tggtgtttgtggctatcgctttttcggattatagggttactaattgtttatttcctggacatgaaaaagagatggatcaagttatggagagttttccttt |
19578258 |
T |
|
| Q |
108 |
gatggttggaattgtttgtagcggtttgtttcttatttttccaacttcaaggcgtggaattggctgcatg |
177 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
19578259 |
gatggttggaataatttgtagcggtttgttccttatttttcctacttcaaggcatggaattggatgcatg |
19578328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University