View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_393 (Length: 238)
Name: NF7850A_low_393
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_393 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 12122859 - 12122625
Alignment:
| Q |
4 |
agtttggtgttattggttttatggattctgtctaaagtaatcttcattatgtccctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122859 |
agttcggtgttattggttttatggattctgtctaaagtaatcttcattatgtctctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
12122760 |
T |
|
| Q |
104 |
cagcttatcattttctggtttttctcttcccttttcatataattcttgatttcgtatgtttaatagcttttttgacaatttatattgtcatttgtgttca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
12122759 |
cagcttatcattttctggtttttctcttcccttttcatataattcttgatttcatatgtttaatagcttttttgacaatttttattgttatttgtgttca |
12122660 |
T |
|
| Q |
204 |
atagatacagcttcagtagcaaaatggtgaagctg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122659 |
atagatacagcttcagtagcaaaatggtgaagctg |
12122625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 172 - 238
Target Start/End: Complemental strand, 14692210 - 14692144
Alignment:
| Q |
172 |
tttttgacaatttatattgtcatttgtgttcaatagatacagcttcagtagcaaaatggtgaagctg |
238 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
14692210 |
tttttgacaatttttgttgttatttgtgttcaatggatacagcttcagtaacaaaatggtgaagctg |
14692144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University