View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_394 (Length: 238)
Name: NF7850A_low_394
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_394 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 27 - 227
Target Start/End: Complemental strand, 40626313 - 40626113
Alignment:
| Q |
27 |
ctcaagcctaagggttgcataaaagatgagcgagtattcaccatctgattcaatccattttcaggatgatcatgtgtttgtggtactggtgatgacagaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40626313 |
ctcaagcctaagggttgcataaaagatgagtgagtattcaccatctgattcaatccattttcaggatgatcatgtgtttgtggtactggtgatgacagaa |
40626214 |
T |
|
| Q |
127 |
gagagagagcacaagaagtgttgttgtcacaaaacattttgtatctttctgaaaaaggattggtcctgctaaaggtgcgactcatggatgaagctggaag |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40626213 |
gagagagagcacaagaagtgttgttgtcacaaaacattttgtatctttctgaaaaaggattggtcctgctaaacgtgcgactcatggatgaagctggaag |
40626114 |
T |
|
| Q |
227 |
a |
227 |
Q |
| |
|
| |
|
|
| T |
40626113 |
a |
40626113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University