View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_396 (Length: 237)
Name: NF7850A_low_396
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_396 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 25 - 228
Target Start/End: Complemental strand, 386010 - 385807
Alignment:
| Q |
25 |
caaaacatcactagctgtcacatccacagaatatcccatggtcttcatttcaagtagaactttggcagcaacatccacaagcttcttattagccagtaga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386010 |
caaaacatcactagctgtcacatccacagaatatcccatcgtcttcatttcaagtagaactttggcagcaacatccacaagcttcttattagccagtaga |
385911 |
T |
|
| Q |
125 |
gataaaagaacagtgtaagtgcttaggcctggccttaaacctgcattagtcattgaattgtacagtttgatggcatgatcaatttgtccagacgcagcat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || | ||||| |
|
|
| T |
385910 |
gataaaagaacagtgtaagtgcttaggcctggccttaaacctgcattagtcattgaattgtacagtttcatggcatgatcaatttgtccggatgaagcat |
385811 |
T |
|
| Q |
225 |
gcat |
228 |
Q |
| |
|
|||| |
|
|
| T |
385810 |
gcat |
385807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 25 - 228
Target Start/End: Original strand, 38729532 - 38729735
Alignment:
| Q |
25 |
caaaacatcactagctgtcacatccacagaatatcccatggtcttcatttcaagtagaactttggcagcaacatccacaagcttcttattagccagtaga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
38729532 |
caaaacatcactagctgtcacatccacagaatatcccattgtcttcatttcaagtagaactttggcagcaacatccaccagcttcttattagcaagtaga |
38729631 |
T |
|
| Q |
125 |
gataaaagaacagtgtaagtgcttaggcctggccttaaacctgcattagtcattgaattgtacagtttgatggcatgatcaatttgtccagacgcagcat |
224 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
38729632 |
gataaaagaacagtataagtgctcaggcctggccttaaacctgcattagtcattgaattgtacagtttcatagcatgatcgatttgtccagacgcagcat |
38729731 |
T |
|
| Q |
225 |
gcat |
228 |
Q |
| |
|
|||| |
|
|
| T |
38729732 |
gcat |
38729735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University