View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_401 (Length: 237)
Name: NF7850A_low_401
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_401 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 16067567 - 16067333
Alignment:
| Q |
1 |
tttgagaaaaactgcactttaaagcatcaacaaaatcataatgctgctgtaattttgttaatcgcaccgcccatccaaacatagctaatagctatctaga |
100 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16067567 |
tttgataaaaactacactttaaagcatcaacaaaatcacaatgctgctgtaattttgttaatctcaccgcccatccaaacatagctaatagctatctaga |
16067468 |
T |
 |
| Q |
101 |
tttgtggcaaattactattataccggcaagtcatccttggcttcatctcactttcaacctcgccatgaaagactctttgaccataaattaacttatccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16067467 |
tttgtggcaaattactattataccggcaagtcatccttggcttcatctcactttcaacctctccatgaaagactctttgaccataaattaacttatccat |
16067368 |
T |
 |
| Q |
201 |
tataagttataccaatgtttgctctattttgctat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16067367 |
tataagttataccaatgtttgctctattttgctat |
16067333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 114 - 177
Target Start/End: Complemental strand, 16072607 - 16072544
Alignment:
| Q |
114 |
actattataccggcaagtcatccttggcttcatctcactttcaacctcgccatgaaagactctt |
177 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
16072607 |
actaatataccggcaagtcatccttggctccatttcactttcaacctctccatgaaagactctt |
16072544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University