View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_412 (Length: 234)
Name: NF7850A_low_412
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_412 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 24 - 234
Target Start/End: Complemental strand, 43875994 - 43875784
Alignment:
| Q |
24 |
aaagggtcggtgccgttttctcaagtgtcaaatttgagtgctcaaaactatgaggaaggtgttgatggtgatgctgttgatatggctgaaatgccacctc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875994 |
aaagggtcggtgccgttttctcaagtgtcaaatttgagtgctcaaaactatgaggaaggtgttgatggtgatgctgttgatatggctgaaatgccacctc |
43875895 |
T |
 |
| Q |
124 |
agagtttgattgctgagttggctagtggattaagggaaagattgggacttaatcttttcaatgttgatgtgattagagatggtaaaaatcccagaaggta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875894 |
agagtttgattgctgagttggctagtggattaagggaaagattgggacttaatcttttcaatgttgatgtgattagagatggtaaaaatcccagaaggta |
43875795 |
T |
 |
| Q |
224 |
tcttgtgattg |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
43875794 |
tcttgtgattg |
43875784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University