View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_427 (Length: 231)
Name: NF7850A_low_427
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_427 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 26825549 - 26825754
Alignment:
| Q |
1 |
cctcatcagaagaaactcctaagtcttgcaccttttgaagtaatcttccttgatacagaatctctgaaattagtcttgtataaggcacactcttcttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26825549 |
cctcatcagaagaaactcctaagtcttgcaccttttgaagtaatcttccttgatacagaatctctgaaattagtcttgtataaggcacactcttcttcca |
26825648 |
T |
|
| Q |
101 |
tttgattccttctctgatagaagtgcatatatggttgaagatatatgctggaagatttattagacatttttcaataaggaacaataggaaatgtttatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26825649 |
tttgattccttctctgatagaagtgcacatatggttgaagatatatgctggatgatttattagacatttttcaataaggaacaataggaaatgtttatga |
26825748 |
T |
|
| Q |
201 |
tcctag |
206 |
Q |
| |
|
|||||| |
|
|
| T |
26825749 |
tcctag |
26825754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 26824217 - 26824260
Alignment:
| Q |
164 |
acatttttcaataaggaacaataggaaatgtttatgatcctagg |
207 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26824217 |
acatttttaaataaggaacaatatgaaatgtttatgattctagg |
26824260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University