View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_440 (Length: 230)
Name: NF7850A_low_440
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_440 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 54 - 201
Target Start/End: Complemental strand, 1575910 - 1575764
Alignment:
| Q |
54 |
tataaacatgtaacaattatagttttagtccagtaagctgctattgtatattttccatcattttttgaaggtatttagttttgatttacaaataatactg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
1575910 |
tataaacatgtaacaattatagttttagtccagtaagctgctattgtatattttccatcattttttgaaggtatttag-tttgatttacaaataatacgg |
1575812 |
T |
|
| Q |
154 |
gttcaaagcaatttgttggacgagccaaggcgaactagaagcgagcaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1575811 |
gttcaaagcaatttgttggacgagccaaggcgaactagaagcgagcaa |
1575764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University