View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_463 (Length: 230)
Name: NF7850A_low_463
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_463 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 35 - 210
Target Start/End: Complemental strand, 38124822 - 38124647
Alignment:
| Q |
35 |
cacacaaaaacaaattcagctgtgtaagtagaaaaaagtgttttcaactgcagatcgtggaatatagcagtttgttcaaactctattaagctacagagtt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38124822 |
cacacaaaaacaaattcagctgtgtaagtagaaaaaagtgttttcaagtgtagatcgtggaatatagcagtttgttcaaactctattaagttacagagtt |
38124723 |
T |
 |
| Q |
135 |
tcatagctactattcgacatcactttgttctaaacagcgtatcacgaaccaatagcaatttatttaaattccatag |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124722 |
tcatagctactatttgacatcactttgttctaaacagcgtatcacgaaccaatagcaatttatttaaattccatag |
38124647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 114
Target Start/End: Original strand, 34925257 - 34925293
Alignment:
| Q |
78 |
tcaactgcagatcgtggaatatagcagtttgttcaaa |
114 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
34925257 |
tcaattgcagatcgtggaaaatagcagtttgttcaaa |
34925293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University