View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_465 (Length: 230)
Name: NF7850A_low_465
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_465 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 31425555 - 31425781
Alignment:
| Q |
1 |
ttaagcgaaaagactatactaatatcgagttcatctgaatctttagtaagtaaaatttagcaaaaaattgttccaccgttgaacttggaatttttcaaat |
100 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31425555 |
ttaagcgaaaagactaaactaatctcgagttcatccgaatatttagtaagtaaaatttagcaaaaaattgttccaccgttgaacttggaatttttcaaat |
31425654 |
T |
 |
| Q |
101 |
gatttgtcatagagagcatatcaaccacttgagacaaatcaattaatttatag---nnnnnnnnnnggtgaaaatcgggtgtccttcgtgcatgcaactg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||| ||||||||||||||||| |||||| |
|
|
| T |
31425655 |
gatttgtcatagagagcatatcaaccactcgagacaaatcaattaatttattgttatttttttttttgtgaaaatggggtgtccttcgtgcatacaactg |
31425754 |
T |
 |
| Q |
198 |
cagagactaatctcttgagtcttgtag |
224 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
31425755 |
tagagactaatctcttaagtcttgtag |
31425781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 220
Target Start/End: Original strand, 24579434 - 24579485
Alignment:
| Q |
169 |
aaatcgggtgtccttcgtgcatgcaactgcagagactaatctcttgagtctt |
220 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
24579434 |
aaatcgggtatcctccgtgtatgcaactgcagagactaatctctcgagtctt |
24579485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 164 - 222
Target Start/End: Complemental strand, 1424739 - 1424681
Alignment:
| Q |
164 |
ggtgaaaatcgggtgtccttcgtgcatgcaactgcagagactaatctcttgagtcttgt |
222 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
1424739 |
ggtgtaaatcgggtgtccttcgtgcgcgcaactgcggagactaatctctcaagtcttgt |
1424681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University