View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_466 (Length: 230)
Name: NF7850A_low_466
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_466 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 53331002 - 53330779
Alignment:
| Q |
1 |
ttcagacagcttagcgccccctttcaagcgctttacaataatttcagcatctgtttccttcaagaaatggccattctgatctgaagataggatccattga |
100 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53331002 |
ttcagacagcttagtgccacctttcaagcactttacaataatttcagcatctgtttccttcaagaaatggccattctgatctgaagataggatccattga |
53330903 |
T |
|
| Q |
101 |
agccccaccgcagcgctattatttcagccatagtaagagacactcggatattgtctaactttgttgcagcaaacttgacattccctccattgtctctaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53330902 |
agccccaccgcagcgctattatttcagccatagtaagagacactcggatattgtctaactttgttgcagcaaacttgacattccctccattgtctctaac |
53330803 |
T |
|
| Q |
201 |
caccgttccacgtcccattaggcc |
224 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
53330802 |
caccattccacgtcccattaggcc |
53330779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 39582846 - 39582814
Alignment:
| Q |
154 |
tctaactttgttgcagcaaacttgacattccct |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
39582846 |
tctagctttgttgcagcaaacttgacattccct |
39582814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University