View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_467 (Length: 230)
Name: NF7850A_low_467
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_467 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 124 - 225
Target Start/End: Complemental strand, 49293975 - 49293874
Alignment:
| Q |
124 |
ttaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattgttgcatgcttcagcgacggaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49293975 |
ttaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattgttgcatgcttcagcgacggaa |
49293876 |
T |
|
| Q |
224 |
gt |
225 |
Q |
| |
|
|| |
|
|
| T |
49293875 |
gt |
49293874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 49294098 - 49294033
Alignment:
| Q |
1 |
attgaattgaataccactgaaatggagtctggatattgaatcaacaaatcttgaagaactagatcc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294098 |
attgaattgaataccactgaaatggagtctggatattgaatcaacaaatcttgaagaactagatcc |
49294033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University