View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_482 (Length: 229)
Name: NF7850A_low_482
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_482 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 39942843 - 39942612
Alignment:
| Q |
1 |
gaacatatcatggtggatatttggtcattgttcaattcttctagatgatgttaatgatcatacaaaaaacaaatctcacataaaaaagaaattagacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39942843 |
gaacatatcatggtggatatttggtcattgttcaattcttctagatgatgttaatgatcatacaaaaaacaagtctcacataaaaatgaaattagacatg |
39942744 |
T |
|
| Q |
101 |
aaaagagtttattacaagtgacaccccaatattgaccccagaatattttatgagcctcgttgaatctattatatcccctaaaacaacaacctaatgagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39942743 |
aaaagagtttattacaagtgacaccccaatattgaccccagaatattttatgagcctcgttgaatctattatatcccctaaaacaacaacctaatgagaa |
39942644 |
T |
|
| Q |
201 |
acaaaac-cga--caatttgccagaatcatga |
229 |
Q |
| |
|
||||||| || ||||||||||||||||||| |
|
|
| T |
39942643 |
acaaaacatgatgcaatttgccagaatcatga |
39942612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University