View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_489 (Length: 228)
Name: NF7850A_low_489
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_489 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 29408622 - 29408425
Alignment:
| Q |
18 |
aatattgctcattgcaatcatatttaagccacacatcattgatgaagttgaccatcttagcgcaaatcaccatagctaacttttttcttttgtaggaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29408622 |
aatattgctcattgcaatcatatttaagccacacatcattaatgaagttgaccatcttagcgcaaatcaccatagctaacttttttcttttgtaggaaat |
29408523 |
T |
|
| Q |
118 |
ttctaaaccatatggctgacatttttggatatcttttgagaccannnnnnnaatctacaaagtctattccattcctcactctatagcctgatgtccat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
29408522 |
ttctaaaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattccagtcctcactctatagcctaatgtccat |
29408425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 157
Target Start/End: Complemental strand, 29425821 - 29425736
Alignment:
| Q |
72 |
tcttagcgcaaatcaccatagctaacttttttcttttgtaggaaatttctaaaccatatggctgacatttttggatatcttttgag |
157 |
Q |
| |
|
|||||||| |||||||||| |||| |||| | |||||| ||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
29425821 |
tcttagcgtgaatcaccatatgcaactattttatgttgtagaaaattcttgaaccatacagctgacatttttggatatcttttgag |
29425736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University