View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_497 (Length: 227)
Name: NF7850A_low_497
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_497 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 52848558 - 52848357
Alignment:
| Q |
1 |
attgcttgattacattctacatctcattttttgtgttcttgtctacagccctcatttgttgggttcaatggctcaaccttctgatcggactttctttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52848558 |
attgcttgattacattctacatctcattttttgtgttcttgtctacagccctcatttgttgggttcaatggctcaaccttctgatcggactttctttcaa |
52848459 |
T |
|
| Q |
101 |
ttcaaagacgtggacagtttcacaagcaaaagatctattcatgtttgtgtattaatataaatttgtatgtgtaataattgttgtgaacgaatacgggtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52848458 |
ttcaaagacgtggacagtttcacaagcaaaagatctattcatgtttgtgtattaatataaatttgtatgtgtaataattgttgtgaacgaatacgggtga |
52848359 |
T |
|
| Q |
201 |
ta |
202 |
Q |
| |
|
|| |
|
|
| T |
52848358 |
ta |
52848357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 86
Target Start/End: Complemental strand, 52851731 - 52851691
Alignment:
| Q |
46 |
cagccctcatttgttgggttcaatggctcaaccttctgatc |
86 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52851731 |
cagcgctcattttttgggttcaatggctcaaccttctgatc |
52851691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University