View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_500 (Length: 227)
Name: NF7850A_low_500
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_500 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 4049577 - 4049357
Alignment:
| Q |
1 |
agaaagtcaagcaaatgtgagatcaccagccattgcgataaagcaagaaaaggtatgaacaacatccgttttcattttatattggattttcaatctgata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
4049577 |
agaaagtcaagcaaatgtgagatcaccagccattgtgataaagcaagaaaaggtatgaacaacatctgttttcattttatattggattctcaatctgata |
4049478 |
T |
|
| Q |
101 |
ttcaatcttgtcttcagtttcctattgagattgtgttatctaaatcgacatttcaatggaacttgcagatttcaaagcctgtttatacaagcacaaaagt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4049477 |
ttcaatcttgttttcagtttcctattgagattgtgttatctaaatcgacatttcaatggaacttgcagatttcaaagcctgtttatacaaccacaaaagt |
4049378 |
T |
|
| Q |
201 |
tgagcacttaagagaatgttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4049377 |
tgagcacttaagagaatgttt |
4049357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University