View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_503 (Length: 226)
Name: NF7850A_low_503
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_503 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 122 - 220
Target Start/End: Original strand, 33896263 - 33896359
Alignment:
| Q |
122 |
catgatcatataacacttcgagtcttccacccttattgatagagaggaaaacaggaaacatgaaattttgattttgttttcaagcctttttgatgaagg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33896263 |
catgatcatataacacttcgagtcttccacccttattgatagag--gaaaacaggaaacatgaaattttgattttgttttcaagcctttttgatgaagg |
33896359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 33896137 - 33896192
Alignment:
| Q |
1 |
tgcacataaagattacttgtagttatgttcactaaacacaggatacaaacatgcag |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33896137 |
tgcacataaagattacttgtagttatgttcactaaacacaggatacaaacatgcag |
33896192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University