View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_515 (Length: 225)
Name: NF7850A_low_515
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_515 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 3 - 225
Target Start/End: Original strand, 53555904 - 53556128
Alignment:
| Q |
3 |
tttaataatattatgagattatacttagacaccctcttgtgcctgcgtgtgtaatgttaagaattctacccaaaattataactttggtttctataggtcg |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53555904 |
tttaataatattatgagattatatttagacaccctcttgtgcctgcgtgtgtaatgttaagaattctacccaaaattataactttggtttctataggtcg |
53556003 |
T |
 |
| Q |
103 |
gagaaaagaaggtacatggcacttgacatc----ataagaatatgaacttaataattcgtacaatttagtcatgacggataagatgctagatttcattgg |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53556004 |
gagaaaagaaggtacatggctcttgacatcatatataagaatatgaacttaat--ttcgtacaatttagtcatgacggataagatggtagatttcattgg |
53556101 |
T |
 |
| Q |
199 |
tgtgtggtttcaaataagaatcagttg |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
53556102 |
tgtgtggtttcaaataagaatcagttg |
53556128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University