View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_517 (Length: 225)
Name: NF7850A_low_517
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_517 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 7933943 - 7933727
Alignment:
| Q |
1 |
tttgtcaaagagttctacgacgaatggaacggttcaagctaataagtacttgctcttgtcttcatgcagttttacacttataaaattgcattagtacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7933943 |
tttgtcaaagagttctacgacgaatggaacggttcaagctaataagtacttgctcttgtcttcatgcagttttacactta--aaattgcattagtacttg |
7933846 |
T |
 |
| Q |
101 |
agaaaaagacaaaaatggagcatgtataggctacttcaagatgctgaaaattgttcatatcttgtaagttgcagcatcagtaactaattcatgcttcatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7933845 |
tgaaaaagacaaaaatggagcatgtataggctacttcaagatgctgaaaattgttcatatcttgtaagttgcagcatcagtaactaattcatgcttcatg |
7933746 |
T |
 |
| Q |
201 |
ctccgaacatagtttttcc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7933745 |
ctccgaacatagtttttcc |
7933727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University