View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_524 (Length: 223)
Name: NF7850A_low_524
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_524 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 5726544 - 5726343
Alignment:
| Q |
16 |
aatgaagcataaaatttagagttaatttttgcacccttaacttcttagtttttccttagcaaacaaataatgtctcgt--------------agagattc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| | | |||||||| |
|
|
| T |
5726544 |
aatgaagcataaaatttagagttaatttttgcaaccttaacttcttagtttttccttagcaa-caaataatgtaacatctacgagcaattgcagagattc |
5726446 |
T |
|
| Q |
102 |
cttttgagttaattgatatcattttatgatattgacatattcgggtatatatttttcatatgcacaggtttaaattggaactccaaactaaataattagt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5726445 |
cttttgagttaattgatatcattttatgatattgacatattcgggtatatatttttcatatgcacaggtttaaattgaaactccaaactaaataattagt |
5726346 |
T |
|
| Q |
202 |
tta |
204 |
Q |
| |
|
||| |
|
|
| T |
5726345 |
tta |
5726343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University