View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7850A_low_528 (Length: 222)

Name: NF7850A_low_528
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7850A_low_528
NF7850A_low_528
[»] chr6 (2 HSPs)
chr6 (63-136)||(2589071-2589144)
chr6 (108-145)||(2589020-2589057)


Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 63 - 136
Target Start/End: Complemental strand, 2589144 - 2589071
Alignment:
63 tgattttggcagcctacagtaggctaggtttattgacccattgtgttggattcttggtggggtttgaagcattg 136  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2589144 tgatttaggcagcctacagtaggctaggtttattgacccattgtgttggattcttggtggagtttgaagcattg 2589071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 145
Target Start/End: Complemental strand, 2589057 - 2589020
Alignment:
108 ttggattcttggtggggtttgaagcattgttttagttg 145  Q
    ||||||||||||||| ||||||||||||||||||||||    
2589057 ttggattcttggtggagtttgaagcattgttttagttg 2589020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University