View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_528 (Length: 222)
Name: NF7850A_low_528
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_528 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 63 - 136
Target Start/End: Complemental strand, 2589144 - 2589071
Alignment:
| Q |
63 |
tgattttggcagcctacagtaggctaggtttattgacccattgtgttggattcttggtggggtttgaagcattg |
136 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2589144 |
tgatttaggcagcctacagtaggctaggtttattgacccattgtgttggattcttggtggagtttgaagcattg |
2589071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 145
Target Start/End: Complemental strand, 2589057 - 2589020
Alignment:
| Q |
108 |
ttggattcttggtggggtttgaagcattgttttagttg |
145 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2589057 |
ttggattcttggtggagtttgaagcattgttttagttg |
2589020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University