View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_534 (Length: 221)
Name: NF7850A_low_534
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_534 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 3e-56; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 7 - 125
Target Start/End: Complemental strand, 1957080 - 1956962
Alignment:
| Q |
7 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaagtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1957080 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaaatt |
1956981 |
T |
 |
| Q |
107 |
caatcaaatccataatatg |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1956980 |
taatcaaatccataatatg |
1956962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 7 - 115
Target Start/End: Complemental strand, 1942161 - 1942053
Alignment:
| Q |
7 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaagtt |
106 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||| |||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
1942161 |
tgttcacccatttcaaacccttttcagtgtatgtctcctcattgtagttgcttgtgaaaaatctatcaccctctagcctcctgcaaagtgcattaaagtt |
1942062 |
T |
 |
| Q |
107 |
caatcaaat |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
1942061 |
caatcaaat |
1942053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 7 - 115
Target Start/End: Complemental strand, 1928184 - 1928076
Alignment:
| Q |
7 |
tgttcacccattccaaaccctttttggtgtatgtctcctcattgaagttgcttgtgaaaaacctatcagcctctagcctccttcaaagtgcatgaaagtt |
106 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||||||||||| ||| |||||||||||| |||||| | ||||||||||| |||||||||| |||||| |
|
|
| T |
1928184 |
tgttgacccattctaacccctttttggtgtatgtctcctcattgtagtagcttgtgaaaaatctatcaccttctagcctcctacaaagtgcattaaagtt |
1928085 |
T |
 |
| Q |
107 |
caatcaaat |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
1928084 |
caatcaaat |
1928076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 36774912 - 36774869
Alignment:
| Q |
164 |
atactgaggcatatcacacttgttcttatgggatttaaaaatta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774912 |
atactgaggcatatcacacttgttcttatgggatttaaaaatta |
36774869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University