View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_539 (Length: 220)
Name: NF7850A_low_539
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_539 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 2 - 215
Target Start/End: Complemental strand, 29280293 - 29280091
Alignment:
| Q |
2 |
ccattttacaactgtcgtcaaagaattttgaaccattgtttaaattgttagcaatcgcaattgcagtcgcaatataaaaagttttgaggtct--gcaacg |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||| |||| | |
|
|
| T |
29280293 |
ccattttacaactgtcgttaaagaattttgaaccattgtttaaattgttggcaatcgcaat------------ataaaaggttttgaggtctctgcaatg |
29280206 |
T |
|
| Q |
100 |
gtatcacaaccattagaccacatcagctgccttttttatggtacaaaggtttgcagcgtaaccacaatttaaaatcatgatttaaactgtgttccaaata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29280205 |
gtatcacaaccattagaccacatcagctgc-ttttttatggtacaaaggtttgcagcctaaccacaatttaaaatcatgatttaaactttgttccaaata |
29280107 |
T |
|
| Q |
200 |
attatatgattaaaat |
215 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
29280106 |
attataagattaaaat |
29280091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 176
Target Start/End: Complemental strand, 42945084 - 42945056
Alignment:
| Q |
148 |
gtttgcagcgtaaccacaatttaaaatca |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42945084 |
gtttgcagcgtaaccacaatttaaaatca |
42945056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University