View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_544 (Length: 219)
Name: NF7850A_low_544
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_544 |
 | |
|
| [»] scaffold0530 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0530 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: scaffold0530
Description:
Target: scaffold0530; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 8046 - 7861
Alignment:
| Q |
19 |
ataaatggcggggattggatactgcaattgttaaggcaacaaactttgatcatgcattgccaaaggaaaaacatattcgatgtatatcgtattctttttc |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046 |
ataaatggcagggattggatactgcaattgttaaggcaacaaactttgatcatgcattgccaaaggaaaaacatattcgatgtatatcgtattctttttc |
7947 |
T |
|
| Q |
119 |
ttttattcaatgcaatgcaattgatccttagttacaagctttgttggagaatgtatgtgaagagtataaagattgtatgttgatgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7946 |
ttttattcaatgcaatgcaattgatccttagttacaagctttgttggagaatgtatgtgaagagtataaagattgtatgttgatgt |
7861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University