View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_545 (Length: 218)
Name: NF7850A_low_545
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_545 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 10 - 169
Target Start/End: Original strand, 45643418 - 45643575
Alignment:
| Q |
10 |
catctccaagaatatggtttgttgccagagtcggcaatgccatagtgatagctaaaaagaagcataaaatcaaagcattagagaaagccattttaatcaa |
109 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45643418 |
catctccaacaatgtggtttgttgccagagtcggcaatggcatagtgatagctaaaaagaagcataaaaccaaagcattagagaaagccattttaatcaa |
45643517 |
T |
 |
| Q |
110 |
ggaggctacgagaatcttgtttgagaattgagatataatgggttagctttatgtaattgc |
169 |
Q |
| |
|
||| |||||||| ||||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
45643518 |
ggaagctacgaggatcttatttgagaattgag--ataatggtttagctttatgtaattgc |
45643575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 10 - 106
Target Start/End: Complemental strand, 45702912 - 45702816
Alignment:
| Q |
10 |
catctccaagaatatggtttgttgccagagtcggcaatgccatagtgatagctaaaaagaagcataaaatcaaagcattagagaaagccattttaat |
106 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||| ||| |||| | ||||||||| |
|
|
| T |
45702912 |
catctccaacaatgtggtttgttgccagagtcggcaatggcatagtgatcgctaaaaagaagcataaaaccaaagccttaaagaatgtcattttaat |
45702816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 10 - 106
Target Start/End: Complemental strand, 45886724 - 45886628
Alignment:
| Q |
10 |
catctccaagaatatggtttgttgccagagtcggcaatgccatagtgatagctaaaaagaagcataaaatcaaagcattagagaaagccattttaat |
106 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||| ||| |||| | ||||||||| |
|
|
| T |
45886724 |
catctccaacaatgtggtttgttgccagagtcggcaatggcatagtgatcgctaaaaagaagcataaaaccaaagccttaaagaatgtcattttaat |
45886628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 45650751 - 45650815
Alignment:
| Q |
30 |
gttgccagagtcggcaatgccatagtgatagctaaaaagaagcataaaatcaaagcattagagaa |
94 |
Q |
| |
|
||||| ||||| |||| ||||| | |||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
45650751 |
gttgcaagagttggcactgccacattgatcactaaaaagaagcctaaaatcaaaggattagagaa |
45650815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University