View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_546 (Length: 217)
Name: NF7850A_low_546
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_546 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 95 - 217
Target Start/End: Complemental strand, 2299261 - 2299139
Alignment:
| Q |
95 |
cgaagaatatgaattttagcttttataataagggatagtaacagcattaaccaaaaggtctatggtacgtcttcacaaccttagaagactcctataatta |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
2299261 |
cgaacaatatgaattttagcttttataataagggatagtagcaacattaaccgaaaggtctatggtacgtcttcacaaccttggaagactcctatagtta |
2299162 |
T |
 |
| Q |
195 |
aagattgctagacccattacaac |
217 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2299161 |
aagattgctagacccattacaac |
2299139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University