View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_553 (Length: 214)
Name: NF7850A_low_553
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_553 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 57 - 193
Target Start/End: Original strand, 9699671 - 9699807
Alignment:
| Q |
57 |
aacctgtgcagcagcgtgattcttgccaaggaacaattaaaatctgaactccttaccaaggttggtttgtggagcatcttagaagtagctgatctgatcg |
156 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699671 |
aacctgtacagcagcgtgattcttgccaaggaacaattaaaatctgaactccttaccaaggttggtttgtggagcatcttagaagtagctgatctgatcg |
9699770 |
T |
|
| Q |
157 |
gtggatctttgcctacttatcaccctgatgtacttct |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699771 |
gtggatctttgcctacttatcaccctgatgtacttct |
9699807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University