View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_558 (Length: 212)
Name: NF7850A_low_558
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_558 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 103 - 209
Target Start/End: Complemental strand, 11051279 - 11051174
Alignment:
| Q |
103 |
atattaggttgagtcgcaaactaaatcactctcttttaaacattttgcagatttgtctcaatggtgctcggaatttcttctatttgttatacatttgaaa |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||| | ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11051279 |
atattaggttgagtcgcgaactaaatcaccat-ttttaaacattttgcggatttgtctcaatggtgctcgtaatttcttctatttgttatacatttgaaa |
11051181 |
T |
 |
| Q |
203 |
attattc |
209 |
Q |
| |
|
||||||| |
|
|
| T |
11051180 |
attattc |
11051174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University