View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_564 (Length: 211)
Name: NF7850A_low_564
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_564 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 14 - 211
Target Start/End: Original strand, 2984609 - 2984806
Alignment:
| Q |
14 |
ggagttgcagcttctggtggatatggtttgttttaattttcaggtgttnnnnnnntacttttgaatgtgtaattattgaacagcttataaaattttataa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2984609 |
ggagttgcagcttctggtggatatggtttgttttaattttcaggtgttaaaaaaatacttttgaatgtgtaattattgaaaagcttataaaattttataa |
2984708 |
T |
|
| Q |
114 |
tgtgaaatatcatatatggtttgagttttaagatcacagggtagaatttaagacttttcatgcttcacattttatgacaactgtaagtaatcaagcaa |
211 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
2984709 |
tgcgaaatatcatatatggtttgagttttaagatcacagagtagaatttaagacttttcatgcttcacattttatgaaaaatgtaaggaatcaagcaa |
2984806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University