View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_57 (Length: 405)
Name: NF7850A_low_57
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 6 - 390
Target Start/End: Original strand, 28803862 - 28804246
Alignment:
| Q |
6 |
acatttcacggtacagccgtgaatcccccggattcagagtctatggtggagggaaaggaacaatactattgctatcatatgagtttgcctttgaggtatc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28803862 |
acatttcacggtacagccgtgaatcccccggattcagagtctatggtggagggaaaggaacaatactattgctatcatatgagtttgcctttgaggtatc |
28803961 |
T |
 |
| Q |
106 |
ctgtggatggagggtctcagtttgaacttgatggaaagaagatgaggatcaaaactgtggctaatagagttagagtgaaagcgtttgttcctgagagtga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28803962 |
ctgtggatggagggtctcagtttgaacttgatggaaagaagatgaggatcaaaactgtggctaatagagttagagtgaaagcgtttgctcctgagagtga |
28804061 |
T |
 |
| Q |
206 |
atctgaccctgaatctgatccagaagaaatggaagtggaaatgtgaaaacctaatttgaagtgtattttgggggaaatgatgaaattgtggattatgttg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28804062 |
atctgaccctgaatctgatccagaagaaatggaagtggaaatgtgaaaacctaatttgaagtgtattttgggggaaatgatgaaattgtggattatgttg |
28804161 |
T |
 |
| Q |
306 |
tttttgtgtgtatgaaaagatgctatgctttgcttgtgttggagattttaggagtagattcaacatgttgtaatcttgtaaatat |
390 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28804162 |
tttttatgtgtatgaaaagatgctatgctttgcttgtgttggagattttaggagtagattcaacatgttgtaatcttgtaaatat |
28804246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University