View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_573 (Length: 209)
Name: NF7850A_low_573
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_573 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 27 - 189
Target Start/End: Complemental strand, 13118397 - 13118235
Alignment:
| Q |
27 |
tactgatacggattccttagggatgataatgcatatgggaaataaattgaataaattcctgcaaaattatttaagacaattaggattcctgcattttgag |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13118397 |
tactgatacggattccttagggatgataatgcatatgggaaataaattgaataaattcctgcaaaattatttaagacaactaggattcctgcattttgag |
13118298 |
T |
 |
| Q |
127 |
tcgtcctaaggacaaagcaaccctaagttaagactgaaaaaagaagacaaaagaggttggaac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13118297 |
tcgtcctaaggacaaagcaaccctaagttaagactgaaaaaagaagacaaaagaggttggaac |
13118235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University