View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_576 (Length: 208)
Name: NF7850A_low_576
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_576 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 3042145 - 3041972
Alignment:
| Q |
18 |
tattctggatatgactatgaatttatgatgtatacataaagnnnnnnn--atctgaacgacaacgttactaactaccaataatttaccagccagataata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3042145 |
tattctggatatgactatgaatttatgatgtatacataaagtttttttttatctgaacgacaacgttactaactaccattaatttaccagccagataata |
3042046 |
T |
|
| Q |
116 |
gagttaagtaacaaaatgcatggggtctgcagtagactttattatccatatacttccagatttgactattaact |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3042045 |
gagttaagtaacaaaatgcatggggtctacagtagactttattatccatatacttccagatttgactattaact |
3041972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University