View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_593 (Length: 204)
Name: NF7850A_low_593
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_593 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 33339793 - 33339962
Alignment:
| Q |
18 |
aagtaaaacccatgttgacaattatggtgaagtaatctcaaatgctgcaaaaggcaaggatgactcgtatgcccaattgttggatttaaaccttgatctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33339793 |
aagtaaaacccatgttgacaattatggtgaagtaatctcaaatgctgcaaaaggcaaggatgactcgtatgcccaattgttggatttaaaccttgatctc |
33339892 |
T |
|
| Q |
118 |
tcactatgaacactccttcgccatcacctatagttgtattgctgaaaacaataattgatcgtgaatttaa |
187 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33339893 |
tcactatgaacactccttcaccatcacctatagttgtattgctgaaaacaataattgatcgtgaatttaa |
33339962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University