View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_599 (Length: 202)
Name: NF7850A_low_599
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_599 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 182
Target Start/End: Original strand, 10706630 - 10706792
Alignment:
| Q |
20 |
gaattgtcagaattaagtgtgctcagatttgggccatttggcattacattcttacacaaaggaggtggagcaacagatgacaaccgcaattggagacggg |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10706630 |
gaattgtcagaatcaagtgtgctcagatttgggccatttggcattacattcttacacaaaggaggtggagcaacagatgacaaccgcaattggagacggg |
10706729 |
T |
|
| Q |
120 |
gtgctcctccaataatcgatgatccgtgcaggtttgcagcattatccttaagaccttgcatga |
182 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10706730 |
gtgctcctccaattatcgatgatccgtgcaggtttgcagcattatccttaagaccttgcatga |
10706792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 6387561 - 6387473
Alignment:
| Q |
20 |
gaattgtcagaattaagtgtgctcagatttgggccatttggcattacattcttacacaaaggaggtggagcaacagatgacaaccgcaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
6387561 |
gaattgtcagaattaagtgtgctcagatttgggccatttggcattacattcctacacaaagggggtggagcaacagatgacaactgcaa |
6387473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 182
Target Start/End: Complemental strand, 6387161 - 6387101
Alignment:
| Q |
122 |
gctcctccaataatcgatgatccgtgcaggtttgcagcattatccttaagaccttgcatga |
182 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
6387161 |
gctcctccaattatagatgatccgtgagggtttgcagcaatatccttaagaccttgcatga |
6387101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University