View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_71 (Length: 387)
Name: NF7850A_low_71
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 12 - 381
Target Start/End: Complemental strand, 10119905 - 10119532
Alignment:
| Q |
12 |
gagagaaggagtgttgcttttggtacaagcaaaaggaac-gcaaagcgccatatttctattaaaccgttatat----ctttaaagcaatgtaaaatatca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10119905 |
gagagaaggagtgttgcttttggtacaagcaaaaggaaccgcaaagcgccatatttctattaaaccgttatatatatctttaaagcaatgtaaaatatca |
10119806 |
T |
|
| Q |
107 |
aacactcaaccatgttataaccgtccctatattttcatttcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaacag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119805 |
aacactcaaccatgttataaccgtccctatattttcattgcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaacag |
10119706 |
T |
|
| Q |
207 |
gacggttcaatcggttgtaccttaaactgacggtttggttattttagcggttcaataccagtttcgttcgggttcaagcaatttaaggcagttgaaccat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119705 |
gacggttcaatcggttgtaccttaaactgacggtttggtta-tttagcggttcaatcccagtttcgttcgggttcaagcaatttaaggcagttgaaccat |
10119607 |
T |
|
| Q |
307 |
gaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119606 |
gaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
10119532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University