View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_85 (Length: 371)
Name: NF7850A_low_85
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_85 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 16 - 352
Target Start/End: Complemental strand, 7753083 - 7752747
Alignment:
| Q |
16 |
tcagggattgagccggttagctggtcttgaaatagggaaagttcgttgtgtttaggaagttgagctaaagaagctggaattgggccagataagttgttaa |
115 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7753083 |
tcagggattgagccggttaactggttttgaaatagggaaagttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaa |
7752984 |
T |
|
| Q |
116 |
cgtatatgtagagttgttctaggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttagt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7752983 |
tgtatatgtagagttgttctaggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttggt |
7752884 |
T |
|
| Q |
216 |
gagtcgacctagtgatgcagggatttggccggtaaacctgttcccggagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattggg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752883 |
gagtcgacctagtgatgcagggatttggccggtaaacctgttcccagagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattggg |
7752784 |
T |
|
| Q |
316 |
ccggtgagactgtccaagctaaagtcgaggtggacaa |
352 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7752783 |
cctgtgagactgtccaagctaaagtcgaggtgaacaa |
7752747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University