View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850A_low_99 (Length: 356)
Name: NF7850A_low_99
Description: NF7850A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850A_low_99 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 11 - 187
Target Start/End: Complemental strand, 42944311 - 42944135
Alignment:
| Q |
11 |
cttctgcctctatcaccnnnnnnnttgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataacta |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42944311 |
cttctgcctctatcaccaaaaaaattgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataacta |
42944212 |
T |
 |
| Q |
111 |
ttttttcaacactttttaggaacttgcaggttctttctgaagcttctgtctattttacaaatgaaatggcgagaata |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42944211 |
ttttttcaacactttttaggaacttgcaggttctttctgaagcttctgtctattttacaaatgaaatggcgagaata |
42944135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 257 - 356
Target Start/End: Complemental strand, 42944065 - 42943966
Alignment:
| Q |
257 |
atatgttccaagtttaaaatggcgaccataccactgaattcttttgtgtaccaattttttgtgctcgccattccaatattcaaagattcttacaggaaat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42944065 |
atatgttccaagtttaaaatggcgaccatgccattgaattcttttgtgtaccaattttttgtgctcgccattccaatattcaaagattcttacaggaaat |
42943966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 35 - 108
Target Start/End: Complemental strand, 33813544 - 33813471
Alignment:
| Q |
35 |
ttgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataac |
108 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| |||||||||||||||||| || | |||||||||||||| |
|
|
| T |
33813544 |
ttgatatgtctgcccctagtttaaaattattgatagaaatgcccctgttcttcattttagttggcgaacataac |
33813471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 35 - 103
Target Start/End: Complemental strand, 49806993 - 49806925
Alignment:
| Q |
35 |
ttgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaac |
103 |
Q |
| |
|
||||||| |||||||||| || |||| ||||||||||| |||| ||||||||| || |||||| |||| |
|
|
| T |
49806993 |
ttgatatatctgcccctaattcaaaatcattgatacaaaagcccttgttcttcatttgatttggtgaac |
49806925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 6e-19; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 35 - 115
Target Start/End: Original strand, 25986604 - 25986684
Alignment:
| Q |
35 |
ttgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||| || | ||||||||||| || |||||| |
|
|
| T |
25986604 |
ttgatatgtctgcccctagttgaaaattattgatacaattgcccctgttcttctttttagttggcgaacatgaccattttt |
25986684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 122
Target Start/End: Complemental strand, 54158702 - 54158617
Alignment:
| Q |
36 |
tgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttttcaacac |
122 |
Q |
| |
|
||||||||||||||||| || |||| ||||| || |||||||| |||||||||||| |||||||| ||| | ||||||||||||| |
|
|
| T |
54158702 |
tgatatgtctgcccctatttcaaaattattgttaaaaatgcccttgttcttcaattaggttggcgaatatagc-attttttcaacac |
54158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 122
Target Start/End: Original strand, 48192825 - 48192906
Alignment:
| Q |
40 |
atgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacataactattttttcaacac |
122 |
Q |
| |
|
||||||||| |||||| |||| |||||||| ||||| ||||||| ||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
48192825 |
atgtctgccactagttcaaaattattgataaaaatgtccctgttgttcaattaggttggcgaacatggc-attttttcaacac |
48192906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 36 - 115
Target Start/End: Original strand, 11735815 - 11735895
Alignment:
| Q |
36 |
tgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacata-actattttt |
115 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||||| ||| | ||| ||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
11735815 |
tgatatgtctacccctagttcaaaattattgatgcaatttcccttgttcttcattttatttggcgaacatacactattttt |
11735895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 39 - 106
Target Start/End: Complemental strand, 11736338 - 11736271
Alignment:
| Q |
39 |
tatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttcaattcatttggcgaacata |
106 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||| | ||||||| ||||| || |||||||| |
|
|
| T |
11736338 |
tatgtctgcccctagttcaaaattattgatacaattgccctttttcttcatttcatctgacgaacata |
11736271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 88
Target Start/End: Original strand, 36155546 - 36155598
Alignment:
| Q |
36 |
tgatatgtctgcccctagttgaaaactattgatacaaatgcccctgttcttca |
88 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||| |||||| ||||||||| |
|
|
| T |
36155546 |
tgatatgtctgcccctagttgagaactaatgttacatatgcccttgttcttca |
36155598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 38 - 84
Target Start/End: Original strand, 19182776 - 19182822
Alignment:
| Q |
38 |
atatgtctgcccctagttgaaaactattgatacaaatgcccctgttc |
84 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||| ||||| |
|
|
| T |
19182776 |
atatgtctgcccctagttcaaaagtattgatacatatgcccttgttc |
19182822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University