View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_high_49 (Length: 242)
Name: NF7850_high_49
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_high_49 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 242
Target Start/End: Original strand, 35073848 - 35074059
Alignment:
| Q |
10 |
aatatgttgtgccatttataaattgttaaaagaaactgacctagctggtcaacgacggtccaaaattaatctcccatatccccatagatgcggcttcggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073848 |
aatatgttgtgccatttataaattgttaaaagaaactgacctagctggtcaacgacggtccaaaattaatctcccatatccccatagatgcggcttcggt |
35073947 |
T |
 |
| Q |
110 |
tctccctaaagccgctaaaaatcccacttggtgggcaacactcctcaggatttaggtggtagttactccggcaccactaatttttgttgcataatttgtc |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073948 |
tctccctaaagccactaaaaatcccactt---------------------attaggtggtagttactccggcaccactaatttttgttgcataatttgtc |
35074026 |
T |
 |
| Q |
210 |
ttcccaatttgttctgctgtggcttggtgcatt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35074027 |
ttcccaatttgttctgctgtggcttggtgcatt |
35074059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University