View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_high_52 (Length: 220)
Name: NF7850_high_52
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_high_52 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 4054925 - 4055127
Alignment:
| Q |
19 |
gatgacccgacccaccgacccaataaccctattcggattttactttgtgtagacacttcgagagaaaaacacat-aaacacagtcaaacttcgaaacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
4054925 |
gatgacccgacccaccgacccaataaccctattcggatcttactttgtgtagacagttcgagagaaaaacacattaaacacagtgaaacttcgaaacaaa |
4055024 |
T |
|
| Q |
118 |
gagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagagaaacaaagatattact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4055025 |
gagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagagaaacaaagatatcact |
4055124 |
T |
|
| Q |
218 |
gtt |
220 |
Q |
| |
|
||| |
|
|
| T |
4055125 |
gtt |
4055127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University