View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7850_high_52 (Length: 220)

Name: NF7850_high_52
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7850_high_52
NF7850_high_52
[»] chr8 (1 HSPs)
chr8 (19-220)||(4054925-4055127)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 4054925 - 4055127
Alignment:
19 gatgacccgacccaccgacccaataaccctattcggattttactttgtgtagacacttcgagagaaaaacacat-aaacacagtcaaacttcgaaacaaa 117  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||    
4054925 gatgacccgacccaccgacccaataaccctattcggatcttactttgtgtagacagttcgagagaaaaacacattaaacacagtgaaacttcgaaacaaa 4055024  T
118 gagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagagaaacaaagatattact 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
4055025 gagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagagaaacaaagatatcact 4055124  T
218 gtt 220  Q
    |||    
4055125 gtt 4055127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University