View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_high_53 (Length: 216)
Name: NF7850_high_53
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 42744058 - 42743859
Alignment:
| Q |
1 |
tagagtggtttacacagaacactggctttatgtttgagcaagcaccttatttcaatgcccttttggtttttattgaggtaaactttattgtcttggattc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42744058 |
tagagtggtttacacaaaacactggctttatgtttgagcaagcaccttatttcaatgcccttttggtttttattgaggtaaactttattgtcttggattc |
42743959 |
T |
 |
| Q |
101 |
tctacctcttctgcattgtctttttgtctcatatcctagaaaacattttagtacatgtctggattaacggtgaaattgacaacaaaatcgcagttgattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42743958 |
tctacctcttctgcattgtctttttgtctcatatcctagacaacattttagtacatgtctggattaacgttgaaattgacaacaaaatcgcagttgattt |
42743859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 13 - 79
Target Start/End: Complemental strand, 42748770 - 42748704
Alignment:
| Q |
13 |
cacagaacactggctttatgtttgagcaagcaccttatttcaatgcccttttggtttttattgaggt |
79 |
Q |
| |
|
|||| ||||||||||||||||| || |||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
42748770 |
cacaaaacactggctttatgttcgaaatagcaccctatttcaatgccattttggtttttattgaggt |
42748704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University