View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7850_low_45 (Length: 342)
Name: NF7850_low_45
Description: NF7850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7850_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 326
Target Start/End: Complemental strand, 19268845 - 19268541
Alignment:
| Q |
18 |
atgtctgaagtcaatatacactgttcctaaccctaattacttgatcatgctgacgccgtatttgccataacatccatgtagccttcctttgctgtcagct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19268845 |
atgtctgaagtcaatatacactgttcctaaccctaattact----catgctgacgccgtatttgccataacatccatgtggccttcctttgctgtcagct |
19268750 |
T |
|
| Q |
118 |
tcaacgtcttgcaagcgatccatgctgatgtcgtttcttgctcgatttgttctgccactattttttcctccctaatttgttctttcttctaaatctctta |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19268749 |
tcaacgtcttgcaagcgatccatactgatgtcgtttcttgatcgatttgttctgccactgttttttcatccctaatttgttctttcttctaaatctctta |
19268650 |
T |
|
| Q |
218 |
aaccctaaaatatcatatttgtgcgagcaacggtaggaatgattataggctttaaattaaacggtagcttcttgatatgttcctctttctttctagtttt |
317 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19268649 |
aaccctgaaatatcatatttgtgcgagtaacggtaggaatgattatagtctttaaattaaacggtagcttcttgatctgttcctctttctttctagtttt |
19268550 |
T |
|
| Q |
318 |
tatattctg |
326 |
Q |
| |
|
||||||||| |
|
|
| T |
19268549 |
tatattctg |
19268541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University